We're moving to rndsystems.com. Come with us!

After July 31, 2026, Tocris Bioscience products and services will no longer be available on this website; you will access all products and services on rndsystems.com. Create your R&D Systems online account today.

CRISPR-Cas9-based Genome Editing For aTAG Knock-ins

This is intended as a guide only.

Cationic Lipid Delivery of CRISPR Ribonucleoprotein Complex into Mammalian Cells

Step 1: Design and Synthesis of Guide RNA and ssDNA HDR Template

  • Guide RNA: Design/identify sgRNA against genomic region of interest for target aTAG knock-in, e.g. 5’ or 3’ region of target gene for aTAG fusion knock-in generation.We recommend trying a minimum of two sgRNAs per target site.
  • ssDNA HDR Template: Design a ssDNA HDR template via de novo synthesis or via a kit production system. The HDR template includes the aTAG sequence, plus any additional linkers/tags desired, flanked by ~80-100 flanking homology arms. Consider including 5' and 3' phosphorothioate bond substitutes to inhibit exonuclease degradation.

Step 2: Prepare RNP Complex

  • Combine the sgRNA and Cas9 (pure Cas9 protein) in a final concentration ratio of approximately 4 µM Cas9 to 4.8 µM sgRNA.
  • Incubate at room temperature for 20 minutes

Step 3: Resuspend Donor Template

  • Resuspend donor template in appropriate buffer, depending on method of transfection, e.g. electroporation, nucleofection. 
  • Leave at room temperature while preparing cells for delivery.

Step 4: Prepare Cells for Delivery 

  • Harvest cells and transfect/electroporate etc. according to manufacturer's instructions.
  • Introduce RNP complex along with HDR template according to manufacturer's instructions. 
  • Transfer cells to appropriate vessel. Allow to recover for 24-48 hours and confirm presence of knock-in via preferred method, e.g. sequencing, etc.

 

N-terminal/C-terminal aTAG Schematic

https://resources.tocris.com/images/protocols/atag-schematic1.jpg

N-terminal aTAG Sequence (1x HA)

tacccctacgacgtgcccgactacgccggcggcggcgcctccaggctctataccctggtgctggtcctgcagcctcagcgagttctcctgggcatgaaaaagcgaggcttcggggccgg
ccggtggaatggctttgggggcaaagtgcaagaaggagagaccatcgaggatggggctaggagggagctgcaggaggagagcggtctgacagtggacgccctgcacaaggtggg
ccagatcgtgtttgagttcgtgggcgagcctgagctcatggacgtgcatgtcttctgcacagacagcatccaggggacccccgtggagagcgacgaaatgcgcccatgctggttccagct
ggatcagatcccc ttcaaggacatgtggcccgacgacagctactggtttccactcctgcttcagaagaagaaattccacgggtacttcaagttccagggtcaggacaccatcctggacta
cacactccgcgaggtggacacggtc

C-terminal aTAG Sequence (1x HA)

ggcgcctccaggctctataccctggtgctggtcctgcagcctcagcgagttctcctgggcatgaaaaagcgaggcttcggggccggccggtggaatggctttgggggcaaagtgcaagaa
ggagagaccatcgaggatggggctaggagggagctgcaggaggagagcggtctgacagtggacgccctgcacaaggtgggccagatcgtgtttgagttcgtgggcgagcctgagct
catggacgtgcatgtcttctgcacagacagcatccaggggacccccgtggagagcgacgaaatgcgcccatgctggttccagctggatcagatccccttcaaggacatgtggcccgacga
cagctactggtttccactcctgcttcagaagaagaaattccacgggtacttcaagttccagggtcaggacaccatcctggactacacactccgcgaggtggacacggtc
ggcggctacccc
tacgacgtgcccgactacgcc

Sequence Key

aTAG (MTH1-based)
2x glycine linker
HA